Review



bruno correia epfl n a  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc bruno correia epfl n a
    Bruno Correia Epfl N A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4102 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bruno+correia+epfl+n+a/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm32330455-259-67-73
    Average 96 stars, based on 4102 article reviews
    bruno correia epfl n a - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Cathepsin S Regulates Antigen Processing and T Cell Activity in Non-Hodgkin Lymphoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER hCTSS-qPCR-Rev: ATTCCCATTGAATGCTCCAG This study N/A mHPRT1-qPCR-For: CAAACTTTGCTTTCCCTGGT This study N/A mHPRT1-qPCR-Rev: CAAGGGCATATCCAACAACA This study N/A mCtss-gRNA-For: GGGAATGCATACCTACCAAG This study N/A mCtss-gRNA-Rev: CTTGGTAGGTATGCATTCCC This study N/A mPdl1-gRNA-For: CGAGGGTTATCCAGAAGCTG This study N/A mPdl1-gRNA-Rev: CAGCTTCTGGATAACCCTCG This study N/A mb2m -gRNA-For: AGTATACTCACGCCACCCAC This study N/A mb2m -gRNA-For: GTGGGTGGCGTGAGTATACT This study N/A hCTSS-gRNA-For: CACCGTTGCATAAAGATCCTACCC This study N/A hCTSS-gRNA-Rev: AAACGGGTAGGATCTTTATGCAAC This study N/A Recombinant DNA pHL-sec Laboratory of Bruno Correia (EPFL) N/A pSPCas9(BB)-2A-GFP (PX458) Addgene cat #48138 pL-CRISPR.EFS.GFP Addgene cat # 57818 Software and Algorithms UCSF Chimera UCSF https://www.cgl.ucsf.edu/chimera/ Attracting Cavities Zoete et al. 2016 PMC4738475 QuPath https://qupath.github.io https://qupath.github.io GraphPad Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ R Open source https://www.r-project.org/ .. REAGENT or RESOURCE SOURCE IDENTIFIER hCTSS-qPCR-Rev: ATTCCCATTGAATGCTCCAG This study N/A mHPRT1-qPCR-For: CAAACTTTGCTTTCCCTGGT This study N/A mHPRT1-qPCR-Rev: CAAGGGCATATCCAACAACA This study N/A mCtss-gRNA-For: GGGAATGCATACCTACCAAG This study N/A mCtss-gRNA-Rev: CTTGGTAGGTATGCATTCCC This study N/A mPdl1-gRNA-For: CGAGGGTTATCCAGAAGCTG This study N/A mPdl1-gRNA-Rev: CAGCTTCTGGATAACCCTCG This study N/A mb2m -gRNA-For: AGTATACTCACGCCACCCAC This study N/A mb2m -gRNA-For: GTGGGTGGCGTGAGTATACT This study N/A hCTSS-gRNA-For: CACCGTTGCATAAAGATCCTACCC This study N/A hCTSS-gRNA-Rev: AAACGGGTAGGATCTTTATGCAAC This study N/A Recombinant DNA pHL-sec Laboratory of Bruno Correia (EPFL) N/A pSPCas9(BB)-2A-GFP (PX458) Addgene cat #48138 pL-CRISPR.EFS.GFP Addgene cat # 57818 Software and Algorithms UCSF Chimera UCSF https://www.cgl.ucsf.edu/chimera/ Attracting Cavities Zoete et al. 2016 PMC4738475 QuPath https://qupath.github.io https://qupath.github.io GraphPad Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ R Open source https://www.r-project.org/ .. Mouse Diffuse Large B Cell Lymphoma cell line A20 (ATCC, cat #ATCC-TIB208 , BALB/c background) and genetic variants were cultured in RPMI-1640 medium (Thermo-Fisher, cat #1870010) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo-Fisher, cat #10270-106), 2 mM l-glutamine (Thermo-Fisher, cat #M11-006), 1 mM sodium pyruvate (Sigma-Aldrich, cat #S8636), 10 mM HEPES (Sigma-Aldrich, cat #H3537), 5 mM d-glucose (Sigma-Aldrich, cat #G8769), 25ug/mL Gentamicin (Thermo-Fisher, cat #G1397) and 50 mM 2-mercaptoethanol (Thermo-Fisher, cat #31350-010,).

    Software:

    Article Title: Cathepsin S Regulates Antigen Processing and T Cell Activity in Non-Hodgkin Lymphoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER hCTSS-qPCR-Rev: ATTCCCATTGAATGCTCCAG This study N/A mHPRT1-qPCR-For: CAAACTTTGCTTTCCCTGGT This study N/A mHPRT1-qPCR-Rev: CAAGGGCATATCCAACAACA This study N/A mCtss-gRNA-For: GGGAATGCATACCTACCAAG This study N/A mCtss-gRNA-Rev: CTTGGTAGGTATGCATTCCC This study N/A mPdl1-gRNA-For: CGAGGGTTATCCAGAAGCTG This study N/A mPdl1-gRNA-Rev: CAGCTTCTGGATAACCCTCG This study N/A mb2m -gRNA-For: AGTATACTCACGCCACCCAC This study N/A mb2m -gRNA-For: GTGGGTGGCGTGAGTATACT This study N/A hCTSS-gRNA-For: CACCGTTGCATAAAGATCCTACCC This study N/A hCTSS-gRNA-Rev: AAACGGGTAGGATCTTTATGCAAC This study N/A Recombinant DNA pHL-sec Laboratory of Bruno Correia (EPFL) N/A pSPCas9(BB)-2A-GFP (PX458) Addgene cat #48138 pL-CRISPR.EFS.GFP Addgene cat # 57818 Software and Algorithms UCSF Chimera UCSF https://www.cgl.ucsf.edu/chimera/ Attracting Cavities Zoete et al. 2016 PMC4738475 QuPath https://qupath.github.io https://qupath.github.io GraphPad Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ R Open source https://www.r-project.org/ .. REAGENT or RESOURCE SOURCE IDENTIFIER hCTSS-qPCR-Rev: ATTCCCATTGAATGCTCCAG This study N/A mHPRT1-qPCR-For: CAAACTTTGCTTTCCCTGGT This study N/A mHPRT1-qPCR-Rev: CAAGGGCATATCCAACAACA This study N/A mCtss-gRNA-For: GGGAATGCATACCTACCAAG This study N/A mCtss-gRNA-Rev: CTTGGTAGGTATGCATTCCC This study N/A mPdl1-gRNA-For: CGAGGGTTATCCAGAAGCTG This study N/A mPdl1-gRNA-Rev: CAGCTTCTGGATAACCCTCG This study N/A mb2m -gRNA-For: AGTATACTCACGCCACCCAC This study N/A mb2m -gRNA-For: GTGGGTGGCGTGAGTATACT This study N/A hCTSS-gRNA-For: CACCGTTGCATAAAGATCCTACCC This study N/A hCTSS-gRNA-Rev: AAACGGGTAGGATCTTTATGCAAC This study N/A Recombinant DNA pHL-sec Laboratory of Bruno Correia (EPFL) N/A pSPCas9(BB)-2A-GFP (PX458) Addgene cat #48138 pL-CRISPR.EFS.GFP Addgene cat # 57818 Software and Algorithms UCSF Chimera UCSF https://www.cgl.ucsf.edu/chimera/ Attracting Cavities Zoete et al. 2016 PMC4738475 QuPath https://qupath.github.io https://qupath.github.io GraphPad Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ R Open source https://www.r-project.org/ .. Mouse Diffuse Large B Cell Lymphoma cell line A20 (ATCC, cat #ATCC-TIB208 , BALB/c background) and genetic variants were cultured in RPMI-1640 medium (Thermo-Fisher, cat #1870010) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo-Fisher, cat #10270-106), 2 mM l-glutamine (Thermo-Fisher, cat #M11-006), 1 mM sodium pyruvate (Sigma-Aldrich, cat #S8636), 10 mM HEPES (Sigma-Aldrich, cat #H3537), 5 mM d-glucose (Sigma-Aldrich, cat #G8769), 25ug/mL Gentamicin (Thermo-Fisher, cat #G1397) and 50 mM 2-mercaptoethanol (Thermo-Fisher, cat #31350-010,).



    Similar Products

    bruno correia epfl n a  (Addgene inc)
    96
    Addgene inc bruno correia epfl n a
    Bruno Correia Epfl N A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bruno+correia+epfl+n+a/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm32330455-259-67-73
    Average 96 stars, based on 1 article reviews
    bruno correia epfl n a - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results